FastQ format

For more information on the FastQ format, see the MAQ FastQ documentation.

FastQ is the standard format for storing the raw reads that come off a sequencer. It extends the FastA format by pairing each base with a quality score that describes how confident the sequencer was in that basecall.

Format

Each read in a FastQ file is described by four lines:

1. A line beginning with @ that holds the sequence identifier and an optional description.

2. The raw sequence (the bases).

3. A line beginning with +, optionally followed by the same identifier again.

4. The quality scores, encoded as ASCII characters, one per base in line 2.

Example

A single FastQ read looks like this:

@HWI-ST911:111:C0N4WACXX:5:1101:2249:2216 1:Y:18:TTAGGC
TTAGGCAGGACAGCTCAGGGCATGAAGTTGTTAATTCAGGACAGGGCATGT
+
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHIJJJ

The identifier line packs a lot of information. Breaking the first example apart:

• HWI-ST911 — the unique instrument name

• 111 — the run id

• C0N4WACXX — the flowcell id

• 5 — the flowcell lane

• 1101 — the tile number within the lane

• 2249 — the x-coordinate of the cluster within the tile

• 2216 — the y-coordinate of the cluster within the tile

• 1 — the member of a pair (1 or 2; paired-end reads only)

• Y — whether the read failed the filter (Y = filtered out, N = passed)

• 18 — control bits (0 when none are on)

• TTAGGC — the index (barcode) sequence

What software use FastQ?

FastQ is the entry point for almost every downstream tool. A few examples:

• Aligners such as Bowtie 2 and TopHat2.

• Assemblers such as Velvet and SPAdes.

• Quality control and trimming tools such as Trimmomatic and FastQC.

How are these files generated?

FastQ files are produced by the sequencer’s basecalling software, which converts the raw signal measured for each cluster into a sequence of bases and their associated quality scores.