FastA format

For more information on the FastA format, see the NCBI BLAST documentation.

FastA is one of the simplest and most widely used file formats in bioinformatics. It is a text-based format for representing nucleotide or amino acid sequences, in which each residue is represented by a single letter.

Format

A FastA file is made up of one or more records. Each record has two parts:

• A single header line that begins with a greater-than symbol (>), followed by an identifier and an optional description.

• One or more sequence lines containing the nucleotide or amino acid sequence.

Example

Below is the beginning of a FastA record for chromosome 1:

>Chr1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT
CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT
CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA
TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT

The header line names the sequence (here, Chr1), and every line after it, up to the next >, is the sequence itself.

Software that use FastA format

Many bioinformatics tools require input in FastA format. Aligners, for example, need the reference genome supplied as a FastA file, and BLAST searches a query sequence (in FastA format) against a database of known sequences.

How are these files generated?

FastA files usually come from public sequence databases (for example a reference genome or a set of gene models downloaded from Ensembl or NCBI), or are produced as the output of an assembly program.